Skip to main content

Table 1 Bacterial strains and plasmids used in this study

From: Potent O-antigen-deficient (rough) mutants of Salmonella Typhimurium secreting Lawsonia intracellularis antigens enhance immunogenicity and provide single-immunization protection against proliferative enteropathy and salmonellosis in a murine model

Strain/plasmid

Description

Reference

S. Typhimurium

 JOL990

S. Typhimurium wild type, challenge strain

Lab stock

 JOL1800

Salmonella Typhimurium ∆lon, ∆cpxR, ∆asd, ∆rfaL; bacterial delivery vector; rough strain

Lab stock

 JOL1809

JOL1800 containing pJHL65 and expressing OptA

This study

 JOL1810

JOL1800 containing pJHL80 and expressing OptB

This study

 JOL1811

JOL1800 containing pJHL65 and expressing FliC

This study

 JOL1812

JOL1800 containing pJHL65 and expressing Hly

This study

E. coli

 BL21(DE3)pLysS

F−, ompT, hsdSB (r −B , m −B ), dcm, gal, λ (DE3), pLysS, Cmr

Promega

 JOL232

F− λ− ϕ80 ∆(lacZYA-argF) endA1 recA1 hadR17 deoR thi-1 glnV44 gyrA96 relA1 ∆asdA4

Lab stock

 JOL1601

JOL232 containing pJHL80-OptA

This study

 JOL1902

JOL232 containing pJHL65-OptB

This study

 JOL1658

JOL232 containing pJHL65-FliC

This study

 JOL1743

JOL232 containing pJHL65-Hly

This study

Plasmids

 pET28a(+)

IPTG-inducible expression vector; Kanamycin resistant

Novagen

 pET32a

IPTG-inducible expression vector; Kanamycin resistant

Lab stock

 pET-optA

pET32a derivative containing optA

This study

 pET-optB

pET28a(+) derivative containing optB

This study

 pET-fliC

pET28a(+) derivative containing fliC

This study

 pET-hly

pET28a(+) derivative containing hly

This study

 pJHL65

asd+ vector, pBR ori, β-lactamase signal sequence-based periplasmic secretion plasmid, 6xHis, high copy number

[24]

 pJHL80

asd+ vector, p15A ori, β-lactamase signal sequence-based periplasmic secretion plasmid, 6xHis, high copy number

 

 pJHL-OptA

pJHL80 harboring optA of L. intracellularis

This study

 pJHL-OptB

pJHL65 harboring optB of L. intracellularis

This study

 pJHL-FliC

pJHL65 harboring fliC of L. intracellularis

This study

 pJHL-Hly

pJHL65 harboring hly of L. intracellularis

This study

Primers

 rfaL DEL OT F

5′-GGATACGATAAACCGCAGTCG

This study

 rfaL DEL OT R

5′- AACCGTGCGCTTGCTGATAAG

This study

 rfaL DEL IN F

5′- ACAAGTTTAGGACTTCGCTGCC

This study

 rfaL DEL IN R

5′-CAGAATGGTATTATGCGGACCG

This study